The Effect of Different Intensities of Treadmill Exercise on FGF23

Gene Expression in Gastrocnemius and Soleus Muscles of Wistar

Rats

Julia Windi Gunadi

1,2 a

, Diana Krisanti Jasaputra

2,3 b

, Decky Gunawan

Ludovicus Edwinanto

, Limdawati Kwee

, Harijadi Pramono

, Adrian Suhendra

Ghita Sariwidyantry

, Hanna Goenawan

7,8 i

and Ronny Lesmana

7,8 j

Department of Physiology, Faculty of Medicine, Maranatha Christian University, Jl. Surya Sumantri, Bandung, Indonesia

Maranatha Biomedical Research Laboratory, Maranatha Christian University, Jl. Surya Sumantri, Bandung, Indonesia

Department of Pharmacology, Faculty of Medicine, Maranatha Christian University, Jl. Surya Sumantri, Bandung,

Indonesia

Department of Biochemistry, Faculty of Medicine, Maranatha Christian University, Jl. Surya Sumantri, Bandung,

Indonesia

Department of Internal Medicine, Maranatha Christian University, Jl. Surya Sumantri, Bandung, Indonesia

Department of Clinical Pathology, Faculty of Medicine, Maranatha Christian University, Jl. Surya Sumantri, Bandung,

Indonesia

Department of Biomedical Sciences, Faculty of Medicine, Universitas Padjadjaran, Jl. Raya Jatinangor, Bandung,

Indonesia

Division of Biological Activity, Central Laboratory, Universitas Padjadjaran, Jl. Raya Jatinangor, Bandung, Indonesia

limdawati@med.maranatha.edu, dokhar.1001tx@yahoo.co.id, suhendraadriansppk@gmail.com,

ghita.sariwidyantry@med.maranatha.edu, hanna@unpad.ac.id, ronny@unpad.ac.id

Keywords: FGF23, Treadmill Exercise, Gastrocnemius, Soleus.

Abstract: Fibroblast growth factor 23 (FGF23) acts as a hormone that regulates phosphate metabolism associated with

kidney function, and an inducer of left ventricle hypertrophy. But the role of FGF23 as a myokine has not

yet to be confirmed. This research aims to investigate the effect of different intensities of treadmill exercise

on FGF23 gene expression in gastrocnemius and soleus muscles of Wistar rats. Twenty male Wistar rats

were given different intensities of treadmill exercise (low, moderate, and high) for as long as 8 weeks.

FGF23 gene expression in gastrocnemius and soleus muscles was examined using semi-quantitative PCR.

In this study, we obtained no change of relative FGF23 mRNA expression in gastrocnemius muscles (p =

0.684) compared to control. But interestingly, we found a significant increase of relative FGF23 mRNA

expression in soleus muscles (p = 0.030). These results showed that different intensities of treadmill

exercise do not stimulate FGF23 gene expression in gastrocnemius muscles of Wistar rats. While the low

intensity of treadmill exercise does not increase FGF23 relative mRNA expression, moderate and high

intensities of treadmill exercise increase FGF23 gene expression in the Wistar rat’s soleus muscles.

https://orcid.org/0000-0003-3645-7486

https://orcid.org/0000-0001-5608-6112

https://orcid.org/0000-0001-6294-4590

https://orcid.org/0000-0002-7768-4047

https://orcid.org/0000-0001-7067-3567

https://orcid.org/0000-0002-2207-7143

https://orcid.org/0000-0003-4873-1673

https://orcid.org/0000-0003-1051-9773

https://orcid.org/0000-0002-1607-4843

https://orcid.org/0000-0002-7425-915X

Gunadi, J., Jasaputra, D., Gunawan, D., Edwinanto, L., Kwee, L., Pramono, H., Suhendra, A., Sariwidyantry, G., Goenawan, H. and Lesmana, R.

The Effect of Different Intensities of Treadmill Exercise on FGF23 Gene Expression in Gastrocnemius and Soleus Muscles of Wistar Rats.

DOI: 10.5220/0010744600003113

In Proceedings of the 1st International Conference on Emerging Issues in Technology, Engineering and Science (ICE-TES 2021), pages 81-86

ISBN: 978-989-758-601-9

1 INTRODUCTION

Fibroblast Growth Factor (FGF) could be divided

into three categories: intracrine, paracrine, and

endocrine (Kyrou, Weickert, Gharanei, Randeva, &

Tan, 2017; Ornitz & Itoh, 2015). The FGF family

consisted of 22 families, with FGF15/19 is being

ortholog in rodents and humans, while FGF23 is

included as an endocrine FGF (Ho & Bergwitz,

2021; Ornitz & Itoh, 2015). As a hormone produced

in osteoblasts and osteocytes, FGF23 is circulated

into many organs such as the kidney, heart, and

skeletal muscles (Faul et al., 2011; López-Otín,

Blasco, Partridge, Serrano, & Kroemer, 2013;

Vervloet, 2019). The action of FGF23 is mediated

by Fibroblast Growth Factor Receptor (FGFR)

together with the cofactor Klotho (Ornitz & Itoh,

2015).

FGF23 is an osteokine (a hormone produced in

bone), with the kidney as its main target, where it

inhibits calcitriol formation by suppressing 25-

hydroxyvitamin D-1α-hydroxylase (Bacchetta et al.,

2013; Ewendt, Feger, & Föller, 2021). Recent

researches have shown that FGF23 is also produced

by cardiomyocytes (Leifheit-Nestler & Haffner,

2018) and induces left ventricular hypertrophy (Faul

et al., 2011). These proofs ensuring the role of

FGF23 in the crosstalk between bone and muscle

(Ewendt et al., 2021; Lara-Castillo & Johnson,

2020). But it is still unclear whether FGF23 could

directly alter skeletal muscle function. A study by

Avin et al proved that FGF23 is indirectly

influenced the proliferation and differentiation of

skeletal muscle cells in an ex vivo experiment (Avin

et al., 2018).

Many factors might alter molecular mechanisms

in skeletal muscle, including the physiological

adaptation process to different intensities of exercise

(MacInnis & Gibala, 2017). Exercise has been well

known as a way to reduce chronic disease risk

(Anderson & Durstine, 2019). American College of

Sports Medicine (ACSM) recommended light to

moderate exercise that may progress gradually to

vigorous exercise, 30 minutes/day and for a

minimum of 3 days a week, for people without

cardiovascular, metabolic, or renal disease (Riebe et

al., 2015). Exercise induces numerous substances

secretion, known as myokines which conduce

positive effects to prevent metabolic disease and

sarcopenia (Son, Chae, Testroet, Du, & Jun, 2018).

It is still unclear whether FGF23 is a myokine or

just an osteokine induced by the change in

phosphate concentration (Lara-Castillo & Johnson,

2020; Takashi & Fukumoto, 2020). Some studies

found increased serum levels of FGF23 after

exercise in humans (Emrich, Dederer, et al., 2019;

Kerschan-Schindl et al., 2021; G Lombardi et al.,

2014). While in mice, a previous study has shown

that 1 week of treadmill exercise upregulated FGF23

in blood, mRNA expression, and mitochondrial

function in skeletal muscle (Li, Fu, Zhao, Ni, &

Shen, 2016). Therefore, in this study, we aim to

investigate the effect of different intensities of

treadmill exercise on gene expression of FGF23 in

the Wistar rat’s skeletal muscles (gastrocnemius and

soleus).

2 METHODS (AND MATERIALS)

2.1 Experimental Animals

We obtained twenty male rats, Wistar strain, aged

about 6-8 weeks, weight about 200-220 grams from

PT Biofarma, Bandung, Indonesia. Rats were

divided into four groups (N=5 for each group) and

put in a cage per group under constant photoperiod

(light/dark cycle every 12 hours), temperature

between 22-24°, and relative humidity. Standard

chow diet (47.3% carbohydrate, 4% fat, 20%

protein, 12% water, 4% fiber, 12% calcium, and

0/7% phosphorus) and water were provided ad

libitum. We experimented on animals based on the

use and care of laboratory animal guidelines

(Committee for the Update of the Guide for the Care

and Use of Laboratory Animals, Institute for

Laboratory Animal Research, Division on Earth and

Life Studies, 2011). The rats were treated following

an approved code of ethics from the Committee of

the Faculty of Medicine, Maranatha Christian

University- Immanuel Hospital Bandung Number

093/KEP/VI/2020.

2.2 Different Intensities of Treadmill

Exercise

After two weeks of the adaptation period, the rats

were trained to run on a treadmill with a gradual

increase of speed and time for another two weeks for

the initial adaptation. The protocol of treadmill

exercise intensities was modified from the previous

protocol, with lactate threshold as the basis for

defining the intensities. The sub-lactate threshold is

categorized as low intensity (10 meters per minute),

lactate threshold as moderate intensity (20 meters

per minute), and supra-lactate threshold as high

intensity (30 meters per minute) (Lesmana et al.,

2016). The treadmill exercise was conducted 5 times

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

a week, from Monday to Friday, 30 minutes per day,

for 8 consecutive weeks. The sedentary group was

used as a control group. At the end of the

experiment, all the animals were sacrificed under

inhalation anesthesia (5% isoflurane). We separated

skeletal muscle tissues (gastrocnemius and soleus

muscles), froze them at -80°C for RNA extraction.

2.3 RNA Extraction, Semi-quantitative

PCR

RNA Trisure isolation reagent (Bioline, BIO-38032,

London, UK) was used according to the protocol of

RNA extraction from the manufacturer. After the

extraction, RNA concentration and purity were

quantified by measuring its absorbance in 260/280

nm (Tecan Infinite M200 Pro, No. 30050303,

Switzerland). For the analysis of FGF23 and

GAPDH gene expression, semi-quantitative PCR

was conducted using a One-Step RT PCR Kit

(Bioline, BIO-65409, London, UK). The process

then continued with electrophoresis (Mupid Exu

Submarine Electrophoresis System, Mupid Exu,

Japan), and the result is visualized using Blupad

Dual LED Blue/White Light Transilluminator (Bio-

Helix, GeneDirex BP001CU, Taiwan).

Quantification of the band was conducted using

Image J. This procedure was adapted from the

previous study (V. M. Tarawan et al., 2019). The

primer sequences of FGF23 and GAPDH have been

summarized in Table 1 (V. Tarawan, Gunadi,

Subekti, Widowati, & Goenawan, 2019; Wang et al.,

2017).

Table 1: Primer Sequence Used in This Study.

Gene

Primer Sequence

Upper strand: sense

Lower strand: antisense

Product

Size (bp)

FGF23

CCTTCCTCTGCACTCGGTAG

301

TGCCAGCTGCCAAGACGGTG

GAPDH

GTTACCAGGGCTGCCTTCTC

GATGGTGATGGGTTTCCCGT 177

2.4 Statistical Analysis

Data are expressed as mean ± SEM. Differences

between groups were evaluated by Analysis of

Variance (ANOVA), followed by an LSD post hoc

test. Statistical significance was set at p<0.05.

3 RESULTS AND DISCUSSION

As a result of this study, we found no difference in

relative ratio of gastrocnemius’s FGF23 mRNA

expression in different intensities of treadmill

exercise were: 0.628 ± 0.05 (low); 0.593 ± 0.03

(moderate); 0.647 ± 0.02 (high); compared to 0.602

± 0.04 (control). This result is presented in figure 1.

Figure 1: Relative Ratio of FGF23 mRNA Expression in

Gastrocnemius Muscle of Wistar Rats After 8 weeks of

Treadmill Exercise with Different Intensities. (Control =

Sedentary, Low =low intensity (10 m/minute), Mod =

moderate intensity (20 m/minute), High = high intensity

(30 m/minute).

We found a significant increase of FGF23

mRNA expression in soleus muscles of Wistar rats

(p = 0.030). Relative ratio of soleus’s FGF23 mRNA

expression in different intensities of treadmill

exercise were: 0.583 ± 0.06 (low); 0.624 ± 0.03

(moderate); 0.648 ± 0.05 (high); compared to 0.552

± 0.02 (control). This result is presented in figure 2.

In this study, we found no difference of FGF23

in gastrocnemius muscle of Wistar rats after 8 weeks

of treadmill exercise with different intensities. But

interestingly, we found a significant increase of

FGF23 gene expression in soleus muscles of Wistar

rats after 8 weeks of treadmill exercise with

moderate and high intensities, while low intensity

did not change FGF23 gene expression compared to

control.

Recent research has proven that the effect of

FGF23 on skeletal muscles was mediated by other

endogenous substances that might act in concert

with FGF23 (Avin et al., 2018). Our result (figure 2)

suggested the increase of FGF23 in soleus muscles

might be associated with exercise alteration of

skeletal muscle metabolism, particularly with

parathyroid hormone (PTH). PTH and FGF23 are

modulating each other’s secretion, FGF23 decreases

The Effect of Different Intensities of Treadmill Exercise on FGF23 Gene Expression in Gastrocnemius and Soleus Muscles of Wistar Rats

Figure 2: Relative Ratio of FGF23 mRNA Expression in

Soleus Muscle of Wistar Rats After 8 weeks of Treadmill

Exercise with Different Intensities. (Control = Sedentary,

Low =low intensity (10 m/minute), Mod = moderate

intensity (20 m/minute), High = high intensity (30

m/minute). * = significant (p<0.05), ** = very significant

(p<0.01).

PTH secretion, and PTH increases FGF23 secretion

(Giovanni Lombardi, Ziemann, Banfi, & Corbetta,

2020; Peacock, 2021). PTH responds to acute and

chronic exercise, and its response might be

influenced by some factors, such as VO

max,

vitamin D status, and hormonal status (Giovanni

Lombardi et al., 2020). A study by Gardinier et al

proved that PTH has a role in bone adaptation to

exercise, and they found an increase of FGF23

mRNA expression in the tibia after 6 days of

treadmill training (Gardinier, Al-Omaishi, Morris, &

Kohn, 2016). But the crosstalk between PTH and

FGF23 in bone and skeletal muscles needs further

investigation. Effects exerted by PTH in muscle

cells might be secondary to the effects on other

tissue. (Lombardi, Ziemann, Banfi, & Corbetta,

2020).

The different results between gastrocnemius

(figure 1) and soleus muscles (figure 2) might be

associated with different properties of their

mitochondria. Gastrocnemius and soleus muscles are

two muscles that differ in their fiber types, while

gastrocnemius muscle is fast type muscle fiber, the

soleus muscle is slow type muscle fiber (Qaisar,

Bhaskaran, & Van Remmen, 2016). Soleus muscles

have a slow contraction speed and predominantly

use oxidative metabolism for energy production,

while gastrocnemius is fast-twitch and uses

glycolytic metabolism (Qaisar et al., 2016).

Therefore, soleus muscles have more and bigger

mitochondria than gastrocnemius muscles (Sanchez,

Li, Bragos, & Rutkove, 2014).

Different properties of gastrocnemius and soleus

muscles could explain the different results of this

study. A previous study concluded that exercise

promotes FGF23 mRNA expression in skeletal

muscle tissue by controlling mitochondrial function

(Li et al., 2016). This is consistent with other studies

that stated endurance training improved the function

of muscle mitochondria which is essential for the

homeostasis of energy in skeletal muscles (Zoladz,

Koziel, Woyda-Ploszczyca, Celichowski, &

Jarmuszkiewicz, 2016). These findings might

explain why the increase of FGF23 was only found

in soleus muscles (figure 2), but not in

gastrocnemius muscles (figure 1).

The effect of FGF23 after exercise is still under

debate because some studies have shown different

results. Some studies claimed that FGF23 increased

after exercise (Emrich, Dederer, et al., 2019;

Kerschan-Schindl et al., 2021; Li et al., 2016; G

Lombardi et al., 2014), while other studies found no

change/decrease ((Buskermolen et al., 2019; Emrich,

Baier, et al., 2019; Keshavarzi, Daryanoosh,

Kooshki Jahromi, & Mohammadi, 2017; Neves et

al., 2021). Different results of those studies might be

affected by intensities, duration, and type of

exercise, high altitude, and phosphate intake. There

is a possibility that FGF23 would increase more

after a long duration, high intensity, over strenuous

exercise, and high phosphorus diet. The limitation of

this study is we have no data regarding phosphate

and PTH concentration which might be correlated

with the increase of FGF23 in soleus muscles. For a

better understanding of the FGF23 mechanism in the

adaptation of skeletal muscles to exercise, we

recommend a more detailed study, especially by

investigating the crosstalk between FGF23 and PTH,

the function of skeletal muscles mitochondria after

exercise, and longer duration of exercise.

4 CONCLUSIONS

In summary, FGF23 gene expression in

gastrocnemius muscles is not upregulated after 8

weeks of treadmill exercise with different intensities

but upregulated in soleus muscles after 8 weeks of

treadmill exercise with moderate and high

intensities. But the role of FGF23 in skeletal muscle

after exercise still needs further investigation.

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

ACKNOWLEDGEMENTS

We would like to thank Susianti, Nurul Ihsani,

Meita, Lydia for the technical assistance for

laboratory experiments. And we also would like to

thank dr Yuni, dr. Nova, dr. Teresa, dr. Cherry for

their assistance in studying the Wistar rats.

FUNDING

This study was funded by Universitas Kristen

Maranatha under Hibah Internal Skema Tambahan

(034/SK/ADD/UKM/VI/2021) to JWG, DKJ, DG,

LE, LK, HP, AS, and GS.

REFERENCES

Anderson, E., & Durstine, J. L. (2019). Physical activity,

exercise, and chronic diseases: A brief review. Sports

Medicine and Health Science, 1(1), 3–10.

https://doi.org/https://doi.org/10.1016/j.smhs.2019.08.

006

Avin, K. G., Vallejo, J. A., Chen, N. X., Wang, K.,

Touchberry, C. D., Brotto, M., … Wacker, M. J.

(2018). Fibroblast growth factor 23 does not directly

influence skeletal muscle cell proliferation and

differentiation or ex vivo muscle contractility.

American Journal of Physiology. Endocrinology and

Metabolism, 315(4), E594–E604.

https://doi.org/10.1152/ajpendo.00343.2017

Bacchetta, J., Sea, J. L., Chun, R. F., Lisse, T. S.,

Wesseling-Perry, K., Gales, B., … Hewison, M.

(2013). Fibroblast growth factor 23 inhibits extrarenal

synthesis of 1,25-dihydroxyvitamin D in human

monocytes. Journal of Bone and Mineral Research :

The Official Journal of the American Society for Bone

and Mineral Research, 28(1), 46–55.

https://doi.org/10.1002/jbmr.1740

Buskermolen, J., van der Meijden, K., Furrer, R., Mons,

D.-J., van Essen, H. W., Heijboer, A. C., …

Bravenboer, N. (2019). Effects of different training

modalities on phosphate homeostasis and local

vitamin D metabolism in rat bone. PeerJ, 7, e6184.

https://doi.org/10.7717/peerj.6184

Committee for the Update of the Guide for the Care and

Use of Laboratory Animals, Institute for Laboratory

Animal Research, Division on Earth and Life Studies,

& N. R. C. (2011). Guide for the care and use of

laboratory animals (8th ed.). Washington (DC).

https://doi.org/10.17226/12910

Emrich, I. E., Baier, M., Zawada, A. M., Meyer, T., Fliser,

D., Scharhag, J., & Heine, G. H. (2019, March).

Plasma FGF23 does not rise during physical exercise

as a physiological model of sympathetic activation.

Clinical Research in Cardiology : Official Journal of

the German Cardiac Society, Vol. 108, pp. 341–343.

Germany. https://doi.org/10.1007/s00392-018-1347-7

Emrich, I. E., Dederer, J., Kircher, A., Klemis, V.,

Lennartz, C. S., Untersteller, K., … Heine, G. H.

(2019). Does a rise in plasma erythropoietin after

high-altitude exposure affect FGF23 in healthy

volunteers on a normal or low-phosphorus diet?

Nutrition, Metabolism, and Cardiovascular Diseases :

NMCD, 29(12), 1361–1367.

https://doi.org/10.1016/j.numecd.2019.09.002

Ewendt, F., Feger, M., & Föller, M. (2021). Myostatin

regulates the production of fibroblast growth factor 23

(FGF23) in UMR106 osteoblast-like cells. Pflugers

Archiv : European Journal of Physiology.

https://doi.org/10.1007/s00424-021-02561-y

Faul, C., Amaral, A. P., Oskouei, B., Hu, M.-C., Sloan, A.,

Isakova, T., … Wolf, M. (2011). FGF23 induces left

ventricular hypertrophy. The Journal of Clinical

Investigation, 121(11), 4393–4408.

https://doi.org/10.1172/JCI46122

Gardinier, J. D., Al-Omaishi, S., Morris, M. D., & Kohn,

D. H. (2016). PTH signaling mediates perilacunar

remodeling during exercise. Matrix Biology : Journal

of the International Society for Matrix Biology, 52–54,

162–175. https://doi.org/10.1016/j.matbio.2016.02.010

Ho, B. B., & Bergwitz, C. (2021). FGF23 signalling and

physiology. Journal of Molecular Endocrinology,

66(2), R23–R32. https://doi.org/10.1530/JME-20-0178

Kerschan-Schindl, K., Skenderi, K., Wahl-Figlash, K.,

Gelles, K., Föger-Samwald, U., Thalmann, M., …

Pietschmann, P. (2021). Increased serum levels of

fibroblast growth factor 23 after an ultradistance run.

Journal of Science and Medicine in Sport, 24(3), 297–

300. https://doi.org/10.1016/j.jsams.2020.09.010

Keshavarzi, Z., Daryanoosh, F., Kooshki Jahromi, M., &

Mohammadi, M. (2017). The effect of 12 weeks of

aerobic exercise on plasma levels of fibroblast growth

factor 23, Angiotensin converting enzyme and left

ventricular hypertrophy in hypertensive elderly

women TT - ﯽﺳﺭﺮﺑ ﺮﻴﺛﺄﺗ 12 ﻪﺘﻔﻫ ﺖﻴﻟﺎﻌﻓ ﯽﺷﺯﺭﻭ ﺮﺑ ﺡﻮﻄﺳ

ﯽﻣﺮﺳ ﺭﻮﺘﮐﺎﻓ ﺪﺷﺭ ﻞﺑﻭﺮﺒﻴﻓ . SSU_Journals, 25(3), 222–229.

Retrieved from http://jssu.ssu.ac.ir/article-1-3998-

en.html

Kyrou, I., Weickert, M. O., Gharanei, S., Randeva, H. S.,

& Tan, B. K. (2017). Fibroblast growth factors: new

insights, new targets in the management of diabetes.

Minerva Endocrinologica, 42(3), 248–270.

https://doi.org/10.23736/S0391-1977.16.02536-0

Lara-Castillo, N., & Johnson, M. L. (2020). Bone-Muscle

Mutual Interactions. Current Osteoporosis Reports,

18(4), 408–421. https://doi.org/10.1007/s11914-020-

00602-6

Leifheit-Nestler, M., & Haffner, D. (2018). Paracrine

Effects of FGF23 on the Heart. Frontiers in

Endocrinology, 9, 278.

https://doi.org/10.3389/fendo.2018.00278

Lesmana, R., Iwasaki, T., Iizuka, Y., Amano, I.,

Shimokawa, N., & Koibuchi, N. (2016). The change in

thyroid hormone signaling by altered training intensity

The Effect of Different Intensities of Treadmill Exercise on FGF23 Gene Expression in Gastrocnemius and Soleus Muscles of Wistar Rats

in male rat skeletal muscle. Endocrine Journal, 63(8),

727–738. https://doi.org/10.1507/endocrj.EJ16-0126

Li, D. J., Fu, H., Zhao, T., Ni, M., & Shen, F. M. (2016).

Exercise-stimulated FGF23 promotes exercise

performance via controlling the excess reactive

oxygen species production and enhancing

mitochondrial function in skeletal muscle.

Metabolism: Clinical and Experimental, 65(5), 747–

756. https://doi.org/10.1016/j.metabol.2016.02.009

Lombardi, G, Corsetti, R., Lanteri, P., Grasso, D.,

Vianello, E., Marazzi, M. G., … Banfi, G. (2014).

Reciprocal regulation of calcium-/phosphate-

regulating hormones in cyclists during the Giro

d’Italia 3-week stage race. Scandinavian Journal of

Medicine & Science in Sports, 24(5), 779–787.

https://doi.org/10.1111/sms.12080

Lombardi, Giovanni, Ziemann, E., Banfi, G., & Corbetta,

S. (2020). Physical Activity-Dependent Regulation of

Parathyroid Hormone and Calcium-Phosphorous

Metabolism. International Journal of Molecular

Sciences, 21(15).

https://doi.org/10.3390/ijms21155388

López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M.,

& Kroemer, G. (2013). The hallmarks of aging. Cell,

153(6), 1194.

https://doi.org/10.1016/j.cell.2013.05.039

MacInnis, M. J., & Gibala, M. J. (2017). Physiological

adaptations to interval training and the role of exercise

intensity. The Journal of Physiology, 595(9), 2915–

2930. https://doi.org/10.1113/JP273196

Neves, R. V. P., Corrêa, H. L., Deus, L. A., Reis, A. L.,

Souza, M. K., Simões, H. G., … Rosa, T. S. (2021).

Dynamic not isometric training blunts osteo-renal

disease and improves the sclerostin/FGF23/Klotho

axis in maintenance hemodialysis patients: a

randomized clinical trial. Journal of Applied

Physiology (Bethesda, Md. : 1985), 130(2), 508–516.

https://doi.org/10.1152/japplphysiol.00416.2020

Ornitz, D. M., & Itoh, N. (2015). The fibroblast growth

factor signaling pathway. Wiley Interdisciplinary

Reviews: Developmental Biology, 4(3), 215–266.

https://doi.org/10.1002/wdev.176

Peacock, M. (2021). Phosphate Metabolism in Health and

Disease. Calcified Tissue International, 108(1), 3–15.

https://doi.org/10.1007/s00223-020-00686-3

Qaisar, R., Bhaskaran, S., & Van Remmen, H. (2016).

Muscle fiber type diversification during exercise and

regeneration. Free Radical Biology & Medicine, 98,

56–67.

https://doi.org/10.1016/j.freeradbiomed.2016.03.025

Riebe, D., Franklin, B. A., Thompson, P. D., Garber, C.

E., Whitfield, G. P., Magal, M., & Pescatello, L. S.

(2015). Updating ACSM’s Recommendations for

Exercise Preparticipation Health Screening. Medicine

and Science in Sports and Exercise, 47

(11), 2473–

2479.

https://doi.org/10.1249/MSS.0000000000000664

Sanchez, B., Li, J., Bragos, R., & Rutkove, S. B. (2014).

Differentiation of the intracellular structure of slow-

versus fast-twitch muscle fibers through evaluation of

the dielectric properties of tissue. Physics in Medicine

and Biology, 59(10), 2369–2380.

https://doi.org/10.1088/0031-9155/59/10/2369

Son, J. S., Chae, S. A., Testroet, E. D., Du, M., & Jun, H.-

P. (2018). Exercise-induced myokines: a brief review

of controversial issues of this decade. Expert Review

of Endocrinology & Metabolism, 13(1), 51–58.

https://doi.org/10.1080/17446651.2018.1416290

Takashi, Y., & Fukumoto, S. (2020). Phosphate-sensing

and regulatory mechanism of FGF23 production.

Journal of Endocrinological Investigation, 43(7), 877–

883. https://doi.org/10.1007/s40618-020-01205-9

Tarawan, V., Gunadi, J., Subekti, T., Widowati, W., &

Goenawan, H. (2019). Effect of Acute Physical

Exercise with Moderate Intensities on FGF23 Gene

Expression in Wistar Rat Heart. Majalah Kedokteran

Bandung, 51, 221–225.

https://doi.org/10.15395/mkb.v51n4.1844

Tarawan, V. M., Gunadi, J. W., Setiawan, Lesmana, R.,

Goenawan, H., Meilina, D. E., … Supratman, U.

(2019). Alteration of Autophagy Gene Expression by

Different Intensity of Exercise in Gastrocnemius and

Soleus Muscles of Wistar Rats. Journal of Sports

Science & Medicine, 18(1), 146–154.

Vervloet, M. (2019). Renal and extrarenal effects of

fibroblast growth factor 23. Nature Reviews.

Nephrology, 15(2), 109–120.

https://doi.org/10.1038/s41581-018-0087-2

Wang, K., Wang, F., Bao, J.-P., Xie, Z.-Y., Chen, L.,

Zhou, B.-Y., … Wu, X.-T. (2017). Tumor necrosis

factor α modulates sodium-activated potassium

channel SLICK in rat dorsal horn neurons via p38

MAPK activation pathway. Journal of Pain Research,

10, 1265–1271. https://doi.org/10.2147/JPR.S132185

Zoladz, J. A., Koziel, A., Woyda-Ploszczyca, A.,

Celichowski, J., & Jarmuszkiewicz, W. (2016).

Endurance training increases the efficiency of rat

skeletal muscle mitochondria. Pflügers Archiv -

European Journal of Physiology, 468(10), 1709–1724.

https://doi.org/10.1007/s00424-016-1867-9

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science