Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen

Is More Correlated with the Number of Total Bacteria than Specific

Major Bacterial Phylum

T. E. Pramudito

, E. G. A. Putri, E. Paluphi, G. Florencia, M. R. Gunawan, M. P. Pratiwi

and Y. Yogiara

Faculty of Biotechnology, Atma Jaya Catholic University of Indonesia, Jl. Raya Cisauk Lapan No.70,

Tangerang, Banten 15345, Indonesia

monarispania@gmail.com, melatipratiwi9@gmail.com, yogiara@atmajaya.ac.id

Keywords: Soybean Tempeh, ETEC, Anti-diarrhea, RT-PCR, Yeast Agglutination Assay.

Abstract: Soybean tempeh can reduce the severity of diarrhoea through the inhibition of enterotoxigenic Escherichia

coli (ETEC) adhesion to intestinal cells. This bioactivity is due to the presence of bioactive oligosaccharides

derived from degradation of soybean matrix by fungi. Tempeh also contains other microorganisms such as

bacteria and there has been no report whether bacteria can also influence the anti-adhesion bioactivity of

tempeh extract against ETEC. In this research, we quantified bacterial population in tempeh samples using

real time polymerase chain reaction (RT-PCR) method and measured the anti-adhesion bioactivity against

ETEC of the extract using yeast agglutination assay. Data from both analyses were compared to see if there

is any correlation between the two variables. Bacterial quantification with RT-PCR was focused on the

enumeration of total bacteria and two specific major bacterial phyla in tempeh: Firmicutes and γ-

Proteobacteria. There was a significantly strong positive correlation (R = 0.733) between total number of

bacteria with anti-adhesion bioactivity of tempeh. However, there was no strong correlation between the

number of Firmicutes and γ-Proteobacteria with anti-adhesion bioactivity. Our finding indicates that the anti-

adhesion bioactivity of tempeh tends to increase following the abundance of bacteria but is not significantly

affected by specific major bacterial phylum.

1 INTRODUCTION

Tempeh is a traditional Indonesian food made from

the fermentation of legumes, most commonly

soybeans, by the mold Rhizopus oligosporus (Nout &

Kiers, 2005). At the end of fermentation process,

fungal mycelia will bind the soybeans together

resulting in a firm and compact cake. The firm texture

of the end product is due to the activity of various

fungal enzymes that break down the soy matrix thus

increasing the digestibility and nutritional value of the

substrate (Nout & Kiers, 2005). One of the products

derived from the fungal enzymatic activity during

fermentation is bioactive oligosaccharides that have

been reported to have anti-diarrheal bioactivity (Kiers

et al., 2002). This bioactivity is due to the capability

https://orcid.org/0000-0001-8547-267X

https://orcid.org/0000-0003-4725-3614

of bioactive oligosaccharides in binding with the

fimbriae of enterotoxigenic Escherichia coli (ETEC)

thus inhibiting adhesion of the pathogenic bacteria to

intestinal cells (Roubos-van den Hil et al., 2010). This

results in the lower incidence of diarrhea since the

pathogenicity of ETEC is determined by its capability

of adhering to the intestines to produce enterotoxins

(Nataro & Kaper, 1998).

Other microorganisms other than fungi, such as

bacteria, are also present in tempeh (Seumahu et al.,

2013). Bacteria in particular plays an important role

in tempeh production for the acidification of soybeans

to inhibit the growth of spoilage microorganism

(Nurdini et al., 2015). Characteristics and nutritional

content of tempeh can also be influenced by bacteria

such as bitterness in tempeh that is correlated with

320

Pramudito, T., Putri, E., Paluphi, E., Florencia, G., Gunawan, M., Pratiwi, M. and Yogiara, Y.

Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen Is More Correlated with the Number of Total Bacteria than Speciﬁc Major Bacterial Phylum.

DOI: 10.5220/0010753500003113

In Proceedings of the 1st International Conference on Emerging Issues in Technology, Engineering and Science (ICE-TES 2021), pages 320-327

ISBN: 978-989-758-601-9

Figure 1: Major steps involved in the production process of the samples used in this experiment.

proteolytic bacteria and vitamin B12 in the product

that is produced by bacteria from the genus of

Klebsiella (Keuth & Bisping, 1994). Considering the

abundance of bacteria in tempeh, a question arises

whether or not these bacteria can influence the anti-

diarrheal potential in tempeh.

The bacterial population in tempeh is dominated

by the phylum Firmicutes (Radita et al., 2018).

Roubos-van den Hil et al. (2010) demonstrated that

fermentation of soybeans by Bacillus sp. can also

result in anti-adhesion bioactivity against ETEC but

the same activity was not observed in soybeans

inoculate with Lactobacillus sp.. However, most

reported experiments so far are focused on the

fermentation of soybean by single bacterial or fungal

culture. It is possible that in real life tempeh

fermentation, these microorganisms might support or

hinder one another during the breakdown of soy

matrix polysaccharides thus influencing the level of

anti-adhesion bioactivity. For example, bacteria could

produce a polysaccharide-degrading enzyme

allowing the substrate to be more accessible for

further degradation by fungi. The opposite could also

take place, that bacteria might consume the bioactive

oligosaccharides thus decreasing bioactivity.

In this research, we focused on the correlation

between anti-adhesion bioactivity against ETEC from

tempeh extract with the population of all bacteria and

two specific phyla: Firmicutes and γ-Proteobacteria.

We decided to focus on those two phyla because both

are reported to be the two major phyla found in

tempeh (Radita et al., 2017). Firmicutes in particular

can produce bacterial exopolysaccharides (EPS) that

can bind to ETEC fimbriae (Wang et al., 2010). We

measured the anti-adhesion bioactivity of tempeh

extract using yeast agglutination assay, which

Saccharomyces cerevisiae act as a model organism

for eukaryotic cells. Real-time polymerase chain

reaction (RT-PCR) was used as a method for bacterial

quantification. Data from both experiments were

statistically analyzed to determine the possibility of

correlation between anti-adhesion bioactivity with the

abundance of all bacteria or certain specific phylum.

2 MATERIALS AND METHODS

2.1 Materials

Tempeh samples used in this experiment consisted of

five commercial tempeh and three tempeh made in

laboratory condition with a variation of starter

culture. All tempeh samples were made from the

same type of yellow-seeded soybeans. Commercial

samples were purchased from tempeh producers in

Bogor (EMP, WJB, and RTI), Jakarta (JKT) and

Surabaya (HNA). EMP, WJB, and JKT were

produced by home-scale industries with the

uncontrolled condition during the production process

while RTI and HNA were produced by standardized

industry with proper environmental control. Tempeh

samples made in the laboratory were prepared with

three different starters: the commercial starters

Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen Is More Correlated with the Number of Total Bacteria than Speciﬁc

Major Bacterial Phylum

321

Raprima (RP; PT. Aneka Fermentasi Industri,

Bandung, Indonesia), Cap Jago (JG; UD. Jaya Mulya,

Kediri, Indonesia) and cassava-based onggok starter

(OG; acquired from a traditional producer in Cisauk,

Banten, Indonesia). Full-fat yellow-seeded elongated

soybeans for tempeh fermentation were purchased

from Pasar Modern Intermoda BSD (Tangerang,

West Java). All tempeh samples were transported and

kept at 4

C prior to analysis. Figure 1 details the

production steps of each sample.

Standard curves for RT-PCR were generated

using pure cultures of Escherichia coli,

Staphylococcus aureus, and Salmonella enterica

ATCC 51741 grown overnight in Luria broth at 37

C. S. cerevisiae and ETEC cultures were used for

yeast agglutination assay and obtained from the

Faculty of Biotechnology, Atma Jaya Catholic

University of Indonesia (Cisauk, Indonesia). D-(+)-

mannose (Sigma Aldrich, Darmstadt, Germany) was

used as a positive control for yeast agglutination

assay.

2.2 Tempeh Fermentation

Lab-made tempeh with starter culture variation were

prepared in the Laboratory of Microbiology, Atma

Jaya Catholic University of Indonesia following the

protocol detailed by Nout and Kiers (2005) with

modifications. Full-fat yellow-seeded elongated

soybeans were soaked overnight in distilled water at

room temperature. Following overnight soaking, the

soybeans were boiled and dehulled. The soybeans

were cooled, dried, and divided to three experimental

groups, each group weighing the same amount. Each

group was mixed thoroughly with a tempeh starter

(0.2 % (w/w) of soybeans) and packed in a perforated

plastic bag followed with incubated at 30

C for 48 h.

The final products were immediately used for the

bioactive oligosaccharide and bacterial DNA

extraction.

2.3 Extraction of Bioactive

Oligosaccharides

Extraction of bioactive oligosaccharides from tempeh

was based on the method described by Roubos-van

den Hil et al. (2010) with modifications. Tempeh

samples were lyophilized for 96 h and homogenized

to obtain tempeh powder. About 1 L of distilled water

was added to 75 g tempeh powder and the suspension

was stirred 1 h at room temperature. The pH of the

suspension was kept at 8.0 through the addition of

NaOH 2 M for every 30 min. The suspension was

centrifuged (30 min, 10000× g, 20

C) and filtered to

obtain crude extract. Following lyophilization for 96

h, the extract was stored at 4

C before analysis.

2.4 Extraction of Bacterial DNA

Total bacterial DNAs from tempeh samples were

extracted based on the method described by Seumahu

et al. (2013) with modifications. Phosphate buffer

saline (PBS) pH 7.4 (150 mL) was added to 50 g of

diced tempeh. The mixture was homogenized and the

suspension was centrifuged at 1000× g for 10 min.

The collected supernatant was centrifuged again at

10000× g for 10 min. The pellets were collected for

bacterial DNA extraction using ZymoBIOMICS™

DNA Miniprep Kit (Zymo Research, Orange, CA,

USA) and the DNA isolate was kept at -20

2.5 Measurement of Anti-adhesion

Bioactivity against ETEC

Anti-adhesion bioactivity of tempeh extract against

ETEC adhesion to eukaryotic cells was measured

using yeast agglutination assay based on the method

described by Mirelman et al. (1980). S. cerevisiae was

grown in potato dextrose broth (HiMedia, India) at 37

C for overnight with shaking. ETEC was grown

overnight without shaking in Luria Bertani broth

(HiMedia) at 37

C. Both cell cultures were

centrifuged at 3000× g for 5 min at 4

C and the

collected pellets were suspended in an equal volume

of PBS pH 7.4. The cells were washed twice in PBS

pH 7.4 and the densities of yeast and ETEC

suspensions were adjusted to OD

600

of 1.0 and 0.5,

respectively.

Tempeh extract was suspended in PBS pH 7.4 to

the concentration of 2 % (w/v) and the suspension

was vortexed for 30 min. The suspension was

centrifuged at 10000× g for 10 min and the

supernatant was collected. Mannose 2 % (w/v) in PBS

pH 7.4 was used as a positive control. Tempeh extract

was mixed with ETEC suspension with the ratio of

1:1 in a 96-wells microtiter plate. The mixture was

incubated at room temperature with orbital shaking

for 10 min. Afterwards, yeast suspension at the same

volume was added into the mixture and followed with

incubation for 30 min with orbital shaking. A mixture

of an equal volume of yeast, ETEC, and PBS pH 7.4

was used as a negative control. The suspension was

transferred onto concave object glass and covered

with cover glass. Cell agglutinates were observed

using a light microscope (Nikon Eclipse E100;

Tokyo, Japan) at 100× magnification. The number of

yeast agglutinates was enumerated using the program

DinoCapture 2.0 (Dino-Lite, Torrance, CA, USA).

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

322

The number of agglutinates was determined as the

sum of agglutinates observed from seven location

points and the measurement was done in triplicates.

Anti-adhesion bioactivity of tempeh extract against

ETEC adhesion to yeast cells was expressed as the

percent of adhesion inhibition which was calculated

with the following formula (1).

% 𝑎𝑑ℎ𝑒𝑠𝑖𝑜𝑛 𝑖𝑛ℎ𝑖𝑏𝑖𝑡𝑖𝑜𝑛 = 100% −







× 100% … (1)

Whereas:

N = average number of agglutinates in sample

C = average number of agglutinates in negative

control

2.6 Bacterial Quantification with

RT-PCR

Quantification of total bacteria, Firmicutes, and γ-

Proteobacteria was carried out using RT-PCR based

on 16s rDNA that are specific to each targeted

bacterial group. Bacterial genomes of E. coli, S.

aureus, and S. enterica ATCC 51741 were extracted

using Wizard® Genomic DNA Purification Kit

(Promega, Madison, WI, USA) to generate standard

curves for total bacteria, Firmicutes, and γ-

Proteobacteria, respectively. DNA isolates from pure

bacterial culture were amplified based on the method

described by Soka et al. (2014) and the amplified

products were diluted tenfold to seven standard

concentrations between 10

– 10

DNA copy/mL.

Samples and standards were each added into PCR

mix comprised of 10 µL Solg™ Real-Time PCR

Smart Mix (SolGent, Daejeon, South Korea), 1 µL

DNA template, 1 µL of each primer (10 pmol.µL

-1

)

(Table 1) and NFW for the total volume of 20 µL. The

primers were designed specifically to amplify the

regions of 16s rDNA that are specific to each of the

bacterial groups used in this experiment. The PCR

reaction conditions were as follow: 94

C for 5 min;

40 cycles of 94

C for 20 sec, 55 – 57

C (Table 1) for

20 sec and 72

C for 50 sec; and 72

C for 15 sec.

Each sample was amplified in triplicate. RT-PCR

reading of the standards showed linearity between C

value and log of DNA copy number (R

> 0.99). The

concentration of a certain bacterial group in a sample

was determined based on the C

value and regression

equation generated from the standard curve. All of the

measurements were done in triplicates.

2.7 Statistical Analysis

The data were statistically analyzed using SPSS

Statistics (IBM Corporation, Armonk, NY, USA).

The correlation between bacterial numbers based on

RT-PCR and anti-adhesion bioactivity of tempeh

extract was determined by calculating the P-value and

Pearson correlation coefficient (R-value) of the two

variables. Correlation was considered significant at P

< 0.01 and strong at R > 0.70.

Table 1. Primers for the amplification of group-specific 16s rRNA gene.

Target bacterial

group

Primer Sequence (5’-3’) Size (bp) Annealing

temperature

(°C)

Citation

Universal bacteria Eub338F ACTCCTACGGGAGGCAGCAG 220 57 (Soka et al.,

2014)

Eub518R ATTACCGCGGCTGCTGG

Firmicutes Firm934F GGAGTATGTGGTTTAATTCGAAGCA 126 56.5 (Guo et al.,

2008)

Firm1060R AGCTGACGACAACCATGCAC

γ-Proteobacteria 1080γF TCGTCAGCTCGTGTYGTGA 122 55 (Karamipour

et al., 2016)

γ1202R CGTAAGGGCCATGATG

Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen Is More Correlated with the Number of Total Bacteria than Speciﬁc

Major Bacterial Phylum

323

Figure 2: Anti-adhesion bioactivity of 2 % (w/v) tempeh extract against ETEC adhesion to S. cerevisiae. Mannose (2 % (w/v))

was used as a positive control. Bars represent the mean of % adhesion inhibition based on triplicates. Error bars represent

standard errors.

Figure 3: Bacterial amount in tempeh samples based on RT-PCR analysis with primers that amplified regions of 16s rDNA

that are specific to γ-Proteobacteria, Firmicutes and total bacteria. Bars represent mean values, expressed as log copy number

per gram total weight of sample (log Q/g), from three replicates of measurement. Error bars represent the standard error of

mean.

3 RESULTS AND DISCUSSION

3.1 Tempeh Samples Showed a

Varying Level of Bacterial

Abundance and Anti-adhesion

Bioactivity

Yeast agglutination assay was used to determine the

bioactivity of tempeh extract in inhibiting ETEC

adhesion to eukaryotic cells. The yeast S. cerevisiae

acted as a model organism for eukaryotic cells which

will form agglutinates in the presence of ETEC. We

quantified the number of agglutinates under a

microscope with 100× magnification and compared

the number of agglutinates between yeast and ETEC

suspension with and without the addition of tempeh

extract. Mannose was used as a positive control due

to its capability to bind to ETEC fimbriae thus

inhibiting yeast agglutination. Yeast and ETEC

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

324

suspension treated with mannose 2% (w/v) resulted in

84.66 ± 1.14 % reduction of agglutinates compared to

untreated suspension. Figure 2 showed that tempeh

samples resulted in varying levels of adhesion

inhibition ranging from 57 to almost 90 %. Tempeh

fermented in laboratory condition (RP, JG, and OG)

tended to have anti-adhesion bioactivity compared to

commercial tempeh (RTI, JKT, HNA, and EMP)

except for WJB. Both extracts from OG and WJB

showed anti-adhesion bioactivity higher than

mannose control at 87.52 ± 4.04 % and 89.95 ± 1.84

% respectively. Overall, this varying level of anti-

adhesion bioactivity was ideal for this experiment as

it allowed us to plot the data against bacterial number

from the next part of this experiment.

Bacterial number in tempeh samples was

determined using RT-PCR to measure the number of

total bacteria and the specific phyla of Firmicutes and

γ-Proteobacteria. Figure 3 showed that the bacterial

numbers in tempeh were also varied from one sample

to another. There was less variation of total bacteria

between tempeh made in the laboratory with different

starter culture indicating that starter culture did not

play a major role in affecting total bacterial number.

Despite the lack of significant variation of total

bacterial number in lab-made tempeh, there was a

variation of bacterial profile composition with RP and

JG containing more γ-Proteobacteria compared to

OG. The bacterial profile in most samples was

dominated by the phylum Firmicutes with the

exception of RP, JG, and JKT that were dominated by

γ-Proteobacteria. RTI and HNA contained the fewest

number of bacteria at 4.55 ± 0.06 and 4.23 ± 0.08 log

Q/g respectively. Both RTI and HNA are commercial

samples that were produced using a standardized

industrial method in a hygienic condition.

3.2 Tempeh Samples Showed a

Varying Level of Bacterial

Abundance and Anti-adhesion

Bioactivity

We plotted the anti-adhesion bioactivity against

ETEC measured using yeast agglutination assay with

the bacterial number in tempeh determined by RT-

PCR. Figure 4A showed that there was a strong

correlation between anti-adhesion bioactivity with a

total bacterial number in tempeh with the R-value of

0.733. The correlation was very significant at P <

0.01. This indicated that the anti-adhesion bioactivity

of tempeh against ETEC tends to increase following

an increase in the number of total bacteria in the

product. The correlation between anti-adhesion

bioactivity and the quantity of both Firmicutes and γ-

Proteobacteria was also significant at P < 0.05.

However, the correlation of both phyla with anti-

adhesion bioactivity was weak with the R-value of

0.446 and 0.488 for Firmicutes and γ-Proteobacteria

respectively (Figure 4B and 4C). Our finding

indicated that the influence of major bacterial phyla

in tempeh on its anti-adhesion bioactivity against

ETEC was minimal compared to the influence from

bacterial community as a whole.

3.3 General Discussion

The anti-adhesion bioactivity of tempeh extract

against ETEC adhesion to eukaryotic cells arises from

the degradation of soy matrix polysaccharide into

bioactive oligosaccharides (Roubos-van den Hil et

al., 2010). This bioactivity is not exclusive to soybean

fermentation by fungal culture (Roubos-van den Hil

et al., 2010). Bacterial fermentation of soybeans

resulted in similar anti-adhesion bioactivity against

ETEC. We found the indication that bacterial role in

the release of bioactive oligosaccharides is also

present in tempeh fermentation by fungal inoculum.

In this experiment, we focused on two specific

phyla: Firmicutes and γ-Proteobacteria. Both phyla

are the major bacterial groups reported in commercial

tempeh that are available in Indonesia (Radita et al.,

2017). We hypothesized there could be two

mechanisms on how the bacterial population can

contribute to the increase of anti-adhesion bioactivity

in tempeh. First, bacteria could break down soy

matrix polysaccharide thus making it more accessible

for further breakdown by fungi or vice versa. Second,

the bacteria produce bacterial exopolysaccharides

(EPS) that can bind to ETEC cells.

It has been reported that most lactic acid bacteria

(LAB) are capable of producing bioactive EPS

(Welman & Maddox, 2003) and these LAB are also

known to be present in tempeh (Radita et al., 2018).

If the latter assumption was true, there should be a

correlation between the Firmicutes population with

anti-adhesion bioactivity. However, the absence of

correlation seemed to indicate that bacterial role on

anti-adhesion bioactivity was more likely due to the

breakdown of soy matrix polysaccharide. We would

like to mention that our finding did not negate the

possibility of EPS or other bacterial secondary

metabolites playing a role on anti-adhesion

bioactivity in tempeh. This research was only focused

on the two major phyla in tempeh and it is possible

that other minor phyla could be more strongly

correlated to anti-adhesion bioactivity. Extraction and

quantification of EPS could also provide more

definitive information on its bioactive potential.

Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen Is More Correlated with the Number of Total Bacteria than Speciﬁc

Major Bacterial Phylum

325

Figure 4: Correlation between anti-adhesion bioactivity of

tempeh extract at 2 % (w/v) (expressed as % adhesion

inhibition) and bacterial number in tempeh based RT-PCR

analysis with primers that amplified regions of 16s rDNA

that are specific to A) total bacteria, B) Firmicutes and C)

γ-Proteobacteria. Regression line is represented by a dotted

line. Correlation between anti-adhesion bioactivity and the

number of each bacterial group was expressed as P-value to

indicate correlation strength and R-value to indicate

correlation significance.

Although we found that total bacterial number is

more strongly correlated to anti-adhesion bioactivity,

the role of the bacterial profile could still not be

crossed out. Figure 2 showed that there was a stark

difference in the anti-adhesion bioactivity of tempeh

extract from three lab-made tempeh against ETEC.

The three samples were produced from the same

batch of soybeans and through the same line of

preparation with the only difference was after they

were inoculated with different starter and incubated

separately at the same temperature. It has been

reported that variation in starter culture does not

affect the total bacterial number in tempeh

(Pramudito et al., 2021; Radita et al., 2017). Figure 3

showed that the number of total bacteria based on RT-

PCR was not too varied especially in the case of RP

and JG.

The contrast between the variation of anti-

adhesion bioactivity and total bacterial number

among the three lab-made samples could imply that

bacterial composition might still play a role in anti-

adhesion bioactivity. A previous report mentioned

that although variation in tempeh starter did not affect

the total bacterial population, it could still influence

bacterial composition in the final product (Pramudito

et al., 2021). JG was made with the commercial starter

‘Cap Jago’ that has been reported to result in a lower

rate of fungal mycelium growth thus allowing

spoilage bacteria, mainly from the phylum γ-

Proteobacteria, to grow uninhibited in the early stage

of fermentation (Pramudito et al., 2021). The rapid

growth of γ-Proteobacteria during the fermentation

process could lead to more degradation of soy matrix

polysaccharides. Bacteria from the phylum γ-

Proteobacteria such as the genus Pseudomonas is

known to be capable of producing polysaccharide-

degrading enzymes such as glycoside hydrolase

(Edwards et al., 2010; Kurakata et al., 2008). More

research is needed to see the role of specific bacterial

growth dynamic on the formation of bioactive

oligosaccharides in tempeh.

4 CONCLUSIONS

The amount of total bacteria in tempeh is strongly

correlated to the anti-adhesion bioactivity of tempeh

extract against ETEC adhesion to eukaryotic cells.

However, there was only a weak correlation between

anti-adhesion bioactivity with the amount of two

major bacterial phyla in tempeh, Firmicutes, and γ-

Proteobacteria. Our finding did not rule out the

possibility that a specific bacterial phylum could still

influence anti-adhesion bioactive in tempeh through

bacterial growth dynamic during the fermentation

process. Results from this experiment could provide

new insight on the development of tempeh into a

functional food product for diarrhea prevention. The

ICE-TES 2021 - International Conference on Emerging Issues in Technology, Engineering, and Science

326

bacterial amount and profile present during tempeh

fermentation process need to be considered to

produce tempeh with optimum bioactive potential

against ETEC adhesion.

REFERENCES

Edwards, J. L., Smith, D. L., Connolly, J., McDonald, J. E.,

Cox, M. J., Joint, I., Edwards, C., & McCarthy, A. J.

(2010). Identification of Carbohydrate Metabolism

Genes in the Metagenome of a Marine Biofilm

Community Shown to Be Dominated by

Gammaproteobacteria and Bacteroidetes. Genes, 1(3),

371–384. https://doi.org/10.3390/genes1030371

Guo, X., Xia, X., Tang, R., Zhou, J., Zhao, H., & Wang, K.

(2008). Development of a real-time PCR method for

Firmicutes and Bacteroidetes in faeces and its

application to quantify intestinal population of obese

and lean pigs. Lett. Appl. Microbiol., 47(5), 367–373.

https://doi.org/10.1111/j.1472-765X.2008.02408.x

Karamipour, N., Mehrabadi, M., & Fathipour, Y. (2016).

Gammaproteobacteria as essential primary symbionts

in the striped shield bug, Graphosoma lineatum

(Hemiptera: Pentatomidae). Sci. Rep., 6.

https://doi.org/10.1038/srep33168

Keuth, S., & Bisping, B. (1994). Vitamin B12 production

by Citrobacter freundii or Klebsiella pneumoniae

during tempeh fermentation and proof of enterotoxin

absence by PCR. Appl. Environ. Microbiol., 60(5),

1495–1499.

Kiers, J. L., Nout, M. J. R., Rombouts, F. M., Nabuurs, M.

J. A., & Meulen, J. V. D. (2002). Inhibition of adhesion

of enterotoxigenic Escherichia coli K88 by soya bean

tempe. Lett. Appl. Microbiol., 35(4), 311–315.

https://doi.org/10.1046/j.1472-765X.2002.011 82.x

Kurakata, Y., Uechi, A., Yoshida, H., Kamitori, S., Sakano,

Y., Nishikawa, A., & Tonozuka, T. (2008). Structural

Insights into the Substrate Specificity and Function of

Escherichia coli K12 YgjK, a Glucosidase Belonging

to the Glycoside Hydrolase Family 63. J Mol. Biol.,

381(1), 116–128.

https://doi.org/10.1016/j.jmb.2008.05.061

Mirelman, D., Altmann, G., & Eshdat, Y. (1980). Screening

of bacterial isolates for mannose-specific lectin activity

by agglutination of yeasts. J Clin. Microbiol., 11(4),

328–331.

Nataro, J. P., & Kaper, J. B. (1998). Diarrheagenic

Escherichia coli. Clin. Microbiol. Rev., 11(1), 142–201.

https://doi.org/10.1128/CMR.11.1.142

Nout, M. J. R., & Kiers, J. L. (2005). Tempe fermentation,

innovation and functionality: Update into the third

millenium. J Appl. Microbiol., 98(4), 789–805.

https://doi.org/10.1111/j.1365-2672.2004.02471.x

Nurdini, A. L., Nuraida, L., Suwanto, A., & Suliantari.

(2015). Microbial growth dynamics during tempe

fermentation in two different home industries—

ProQuest.

Int. Food Res. J, 22(4), 1668–1674.

Pramudito, T. E., Putri, E. G. A., Paluphi, E., & Yogiara, Y.

(2021). The effect of starter culture on bacterial profile

in soybean tempeh. Food Res., 5(1), 380–389.

https://doi.org/10.26656/fr.2017.5(1).436

Radita, R., Suwanto, A., Kurosawa, N., Wahyudi, A. T., &

Rusmana, I. (2017). Metagenome analysis of tempeh

production: Where did the bacterial community in

tempeh come from? Malay. J Microbiol., 13(4), 280–

288.

Radita, R., Suwanto, A., Wahyudi, A. T., & Rusmana, I.

(2018). Firmicutes is the predominant bacteria in

tempeh. Int. Food Res. J, 25(6), 2313–2320.

Roubos-van den Hil, P. J., Nout, M. J. R., van der Meulen,

J., & Gruppen, H. (2010). Bioactivity of tempe by

inhibiting adhesion of ETEC to intestinal cells, as

influenced by fermentation substrates and starter pure

cultures. Food Microbiol., 27(5), 638–644.

https://doi.org/10.1016/j.fm.2010.02.008

Roubos-van den Hil, P. J., Schols, H. A., Nout, M. J. R.,

Zwietering, M. H., & Gruppen, H. (2010). First

Characterization of Bioactive Components in Soybean

Tempe That Protect Human and Animal Intestinal Cells

against Enterotoxigenic Escherichia coli (ETEC)

Infection. J Agri. Food Chem., 58(13), 7649–7656.

https://doi.org/10.1021/jf101379y

Seumahu, C. A., Suwanto, A., Rusmana, I., & Solihin, D.

D. (2013). Bacterial and Fungal Communities in

Tempeh as Reveal by Amplified Ribosomal Intergenic

Sequence Analysis. HAYATI, 20(2), 65–71.

https://doi.org/10.4308/hjb.20.2.65

Soka, S., Suwanto, A., Sajuthi, D., & Rusmana, I. (2014).

Impact of Tempeh Supplementation on Gut Microbiota

Composition in Sprague-Dawley Rats. Res. J

Microbiol., 9(4), 189–198. https://doi.org/10.3923/

jm.2014.189.198

Wang, Y., Gänzle, M. G., & Schwab, C. (2010).

Exopolysaccharide Synthesized by Lactobacillus

reuteri Decreases the Ability of Enterotoxigenic

Escherichia coli To Bind to Porcine Erythrocytes. Appl.

Environ. Microbiol., 76(14), 4863–4866.

https://doi.org/10.1128/AEM.03137-09

Welman, A. D., & Maddox, I. S. (2003).

Exopolysaccharides from lactic acid bacteria:

Perspectives and challenges. Trend Biotechnol., 21(6),

269–274. https://doi.org/10.1016/S0167-7799(03)001

07-0

Bioactivity of Soybean Tempeh against Diarrhea Associated Pathogen Is More Correlated with the Number of Total Bacteria than Speciﬁc

Major Bacterial Phylum

327