Utilization of Intestinal Probiotics to Improve the Degradation and

Absorption of Food and Drug Homologous Flavonoids

Zixun Su

Dalian Huamei School, Dalian, Liaoning Province, 116033, China

Keywords:

Flavone, E. Coli, Degradation Rate, PCR, Deamination Tyrosine, FLR.

Abstract:

Under the condition that the slow degradation rate of flavone in food in the gastrointestinal tract of the human

body has long been a problem for researchers, we constructed and justified a protein to improve the

degradation and absorption rate of flavone. The paper, through methods including polymerase chain reaction

and gel electrophoresis, explores the possible solution for increasing degradation rate with a flr gene. The

FLR enzyme produced throughout the experiment would successfully degrade flavonoids into deamination

tyrosine (DAT) to achieve the goal of having anti-inflammatory function. The paper concludes that with E.

Coli carrying Pet28a-flr-chi-enoR-phy, flavonoids tested can be dissolved and decomposed up to 95% within

6 hours.

1 INTRODUCTION

In modern life, people often have poor resistance and

get sick easily. Due to the situation, flavonoids should

be a good choice as flavones in fruits and vegetables

have been found to help fight cancer and bacteria.

They have antioxidant, hypocholesterolemic, and

anti-inflammatory properties, as well as the ability to

modulate cell signaling and gene expression, which

are linked to disease development. (Thilakarathna S

H, 2013) Nevertheless, the low apparent availability

of flavonoids is currently considered as a problem as

the benefits of flavones cannot be expressed fully.

The enzyme in the human intestinal flora was unable

to practice degrading and absorbing flavonoids well.

(Ravishankar D, 2013) Therefore, attempts to

improve their bioavailability in order to improve the

efficacy of flavonoids are always being made and

studied. (Yang, 2021) Research on flavonoid

degradation has been ongoing, but the way to

improve the absorption of flavonoids in the

gastrointestinal tract of the human body is still to be

found. The situation stayed still until 2020, when

Nature Communication reported a key enzyme FLR

that would initialize the degradation of the flavone. In

this case, flavone functions and can help the human

body absorb various types of flavonoids.

Flavones are largely found in plants. (Leonard,

2006) The research on flavonoids in recent years is

extensive, such as Soybeans flavone, Baicalensis

flavone, and Epimedium flavone. (Geng, 2003) They

are pharmacodynamic compounds and have been

widely used in the treatment of cancer and various

diseases. (Yao, 2004) However, it is unfortunately

that some people do not have the ability to digest

certain groups of flavones, which become detrimental

to their health in this way. During this experiment, we

made E. coli carry the flr gene to more efficiently

produce the FLR enzyme. This manufactured bacteria

can now express the FLR gene well, increase the

degradation rate of flavonoids, and furtherly generate

DAT, which would activate the immune system of the

human body so as to achieve anti-inflammatory,

antibacterial, anti-cancer and other purposes, at the

same time helping reduce clinical treatment costs.

(Ashrafizadeh, 2020)

2 CONCEPTS

Flavonoids belong to a large class of significant

secondary metabolites of plants, which have good

pharmacological activities and important nutrition.

The metabolism, absorption, and excretion of it are

accomplished in the gastrointestinal tract of the

human body. (Chen, 2021) It acts as a role in the

gastrointestinal tract in a physiological way, leading

to the functions of antioxidant, anti-inflammatory,

and anti-cancer as shown in Figure 1.

Su, Z.

Utilization of Intestinal Probiotics to Improve the Degradation and Absorption of Food and Drug Homologous Flavonoids.

DOI: 10.5220/0012001100003625

In Proceedings of the 1st International Conference on Food Science and Biotechnology (FSB 2022), pages 34-41

ISBN: 978-989-758-638-5

 2023 by SCITEPRESS – Science and Technology Publications, Lda. Under CC license (CC BY-NC-ND 4.0)

Figure 1: Multiply diagrams to illustrate the benefit brought by flavonoids (Jeon, 2009).

Figure 2: Chemical process of FLR participating in changing flavone into DAT (Jeon, 2009).

In the past ten years, a large number of studies

have been carried out to discover the digestion and

absorption of flavonoids, especially in the digestive

tract of the human body, with the aim of applying the

functions to foods, drugs, or even synthetic products

to treat diseases. Along with this goal, we managed

to build intestinal engineering probiotics to increase

the degradation of food and drug homologous

flavonoids.

Inspired by a paper from Nature Communication

written by Weihong Jiang Research Group, CAS,

which demonstrated the newly discovered alkene

reductase-flavone reductase (FLR), we started our

project. FLR enzyme not only initiates flavonoid

absorption and degradation in the human body, but it

also has similar effects and functions for another type

of flavonoid, flavonol. According to the paper, the

enzyme comes from intestinal bacteria, so this

experiment should have an outcome that is highly

practicable.

In order to increase the practicability and improve

the feasibility of our experiment, we chose apigenin,

chrysin, luteolin, and diosmetin as four samples for

function tests based on the substrate spectrum

analysis since chronic diseases can be cured or

alleviated by intaking them (see figure 3). (Tang,

2017).

Utilization of Intestinal Probiotics to Improve the Degradation and Absorption of Food and Drug Homologous Flavonoids

Figure 3: Demonstration of part of the substrate spectrum of flavonoids.

Figure 4: Flow chart representing the principle of E. coli carrying pET28a-FLR.

3 DESIGN

By starting with the pET28a vector, we constructed

the pET28a-flr plasmid. After that, we insert it into

the carrier, which is the E. coli, to produce the

engineered strain for realization of the concept of our

product. In the ATLATL lab in Shanghai, we

successfully built the pET28a-flr plasmid and proved

it with methods like polymerase chain reaction and

sequencing.

Next, with the aim of determining the

performance of the E. coli carrying pET28a-flr, we

designed and used two experiments with the four

types of common flavonoids mentioned before, which

include apigenin, chrysin, luteolin, and diosmetin.

With the initial concentration set at 10mg/L, we

measured and recorded the concentration of

flavonoids after 2 hours and 6 hours. We repeat the

enzyme activity test for each flavonoid three times, to

guarantee the credibility of the outcome.

4 RESULT

After we purified the protein, which is the FLR

enzyme, an enzyme activity test to evaluate the

functions of the FLR enzyme was carried out by us.

The same four kinds of flavonoids were used as

samples: apigenin, chrysin, luteolin, and diosmetin.

Starting with an initial flavonoids concentration of

100.05 mg per liter, an OD600 as 1.0, and an FLR

enzyme concentration as 1 mM per liter, we

conducted the tests. Every test is repeated three times

to reduce the errors and limit the uncertainty to the

best of our ability.

The results are recorded for 0h, 2h, and 6h to

demonstrate the changes:

Table 1: Data of concentrations of flavonoids.

Concentration (mg/L) 0h 2h 6h

Apigenin 9.96 2.16 0.03

Chrysin 9.97 2.79 0.12

Luteolin 9.96 2.09 0.11

Diosmetin 10.05 5.15 0.53

FSB 2022 - The International Conference on Food Science and Biotechnology

The results are also shown in the following bar graphs:

Figure 5: Bar graph of the concentration of flavonoids after 2 hours and 6 hours.

Figure 6: Bar graph of the concentration of flavonoids after 2 hours.

As shown in Figure 5, the concentration of the

four types of flavonoids significantly decreased after

6 hours. Although after 6 hours, approximately 0.3-

5% of flavonoids are still left, it can be used to

indicate that the enzyme we made has high activity in

degrading and certain universality in degrading

different flavonoids.

Similarly, in Figure 6, it can be inferred that all

the tested flavonoids have only 1-7% left, which is

near the stage of full degradation. The strong and

undoubtable ability of our E. coli to degrade

flavonoids is shown with the data and visualized

graphs in the way we expected.

To sum up, the E. coli carrying the FLR enzyme

has the ability to degrade various common flavonoids

with certain practicability. In the comparison of the

degradation rates of the tested flavonoids, they should

be ranked from least to greatest: diosmetin < luteolin

< chrysin < apigenin.

5 MODEL

Besides tables and graphs, we also designed models

to represent and forecast the degradation rate of our

FLR enzyme using the data we got from the testing.

In considering about the quantity of our data, we

chose MATLAB as the tool to visualize our results in

the form of model.

Since the data follows a declining trend, we chose

to use the following negative exponential function to

prevent the appearance of negative values in the y-

axis:

𝑑𝑦

𝑑𝑥

𝑎𝑦𝑥

where dy represents the change in y, dx represents

the change in x, and a represents the initial

concentration of the four flavonoids.

In this case, the analytic expression will be:

𝑦𝑏𝑒



𝑐

where a, b, c are constant resulted from the line of

best fit in the models.

According to the modeling results for each

samples showing below, the fitting degrees are the

same.

As shown by Figure 8, these four curves have

pretty similar trends. The functions can be used as a

reference to predict the time needed for our E. coli

carrying pET28a-flr to achieve its efficiency. For

example, it may take 0.8 hours for the bacteria to

degrade half of the apigenin, and it may take 3.9

hours to degrade chrysin to 10% of the original

amount.

Furthermore, the derivative of these curves is also

calculated and visualized by us to directly see their

degradation rate in certain hours:

Utilization of Intestinal Probiotics to Improve the Degradation and Absorption of Food and Drug Homologous Flavonoids

Figure 7: Results of apigenin(a), chrysin(b), luteolin(c), diosmetin(d) is used for modeling.

Figure 8: Line of best fit in exponential mode to represent the curves of degradation.

In Figure 9, though the degradation rate of

diosmetin is much slower than the others during the

first 2 hours of degradation, the rate increases and

turns to be the fastest in the next four hours. Because

Figure 9 shows that the lower the concentration of

flavonoids, the faster the degradation rate, we can

conclude that FLR enzyme should be suitable for

degrading flavonoids in large quantities.

FSB 2022 - The International Conference on Food Science and Biotechnology

Figure 9: Hours vs. degradation rate graph for four tested flavonoids.

Figure 10: Illustration of pET28a-flr-chi-enoR-phy enzyme.

6 PROTEIN CONSTRUCTION

The target fragment for protein expression,

BBa_K3998004, is built into the vector of pET28a.

This fragment, transcribed by the T7 promoter and

ended by the T7 terminator, contains a His tag for

protein purification. Molecular biology experiments

have been carried out by us, in which we successfully

made the fragment in the vector of E. coli BL21.

Detailed descriptions of all component parts are

listed:

6.1 BBa_K3998000

The flr gene, a 6275bp long gene that increases the

rate of flavonoid degradation, is used to create a strain

that secretes enzyme more efficiently. It can assist in

better producing DAT, activate the immune system

of the human body, and achieve the functions of

flavonoids, including anti-inflammatory, anti-cancer,

and antibacterial. Also, treatment costs would be

largely reduced with the participation of this gene.

6.2 BBa_K3998001

Chi, a 510bp long gene used to improve the rate of

flavonoid degradation, is used to create a strain

capable of secreting enzyme more efficiently. With

chi gene’s function of converting dihydroflavone into

chalcone, it can improve degradation rate, DAT

production, and activate the human immune system

to protect the human body from serious diseases like

cancer, inflammation, and tumors. Improving

immunity of the human body would also make

clinical treatment cost less.

6.3 BBa_K3998002

EnoR, a 948bp long gene that increases the

degradation rate of flavonoids, is used to create a

strain that secretes enzyme more efficiently. It has

almost the same function as the chi gene does. With

the enoR gene’s function of converting

dihydroflavone into chalcone, it can improve

degradation rate, DAT production, and activate the

human immune system to protect the human body

from serious diseases like cancer, inflammation, and

tumors. Improving immunity of the human body

would also make clinical treatment cost less.

Utilization of Intestinal Probiotics to Improve the Degradation and Absorption of Food and Drug Homologous Flavonoids

Figure 11: DNA map of plasmids expressing FLR.

Figure 12: DNA map of pET28a and location of flr/chi/enoR/phy on plasmids.

6.4 BBa_K3998003

Phy, a 1068bp long gene that improves flavonoid

absorption, is used to create a strain that secretes

enzyme more efficiently. It has similar functions to

the chi gene and the enoR gene. With phy gene’s

function of converting dihydroflavone into certain

degradation products, it can improve degradation

rate, DAT production, and activate the human

immune system to protect the human body from

serious diseases like cancer, inflammation, and

tumors. Improving immunity of the human body

would also make clinical treatment cost less.

7 EXPERIMENTAL APPROACH

During the experiment, we managed to build the

plasmid and prove it with methods like polymerase

chain reaction and gel electrophoresis.

FSB 2022 - The International Conference on Food Science and Biotechnology

The pET28a vector is already in the plasmid

library, so we just needed to obtain it from there.

Acquisition of Inserts: introduce homologous

sequences of pET28a vector into the 5’-end of

forward and reverse primers, to make the ends

identical to each other.

Table 2: Acquisition of inserts.

Primer Sequence

Catalase-F-Nhel: atggctagcatgagttcaaataaactgacaact

Catalase-R-XhoI: gtgctcgagttaagaatcttttttaatcggcaa

Recombination: use formula to calculate the

amount of DNA needed for recombination and

diluted pET28a vector and inserts earlier to ensure the

accuracy of loading.

Table 3: Recombination.

Components Recombination

ET28a 107.3ng, convert to volume

flr/chi/enoR/phy 37.3-42.72ng, convert to

volume

Buffe

4ul

Exnase II 2ul

ddH2O To 20ul

8 CONCLUSION

In conclusion, by introducing the pET28a-flr-chi-

enoR-phy into the E. coli BL21, we successfully

increased the degradation rate of the medicine and

food homologous flavonoids. As results showed that

more than 95% of the tested flavonoids were

degraded after 6 hours of time. In this case, the

targeted anti-inflammatory, antibacterial, and anti-

cancer functions of flavonoids would work as

intended. When we were doing the experiment, the

bacteria in the culture medium did not grow at a fast

rate, which limited us to repeating it for 3 times.

Possible errors that may be accidentally included in

the data are not totally eliminated. In the future, since

the FLR enzyme appears to have an incredible

capacity to break down flavonoids, we are looking

forward to testing how the human body would

perform with and without the E. coli with pET28a-flr.

What’s more, in the event that the further experiment

succeeds, we are going to likely attempt to include the

FLR-built microscopic organisms into yogurt. Yogurt

contains a huge number of lactic-corrosive

microscopic organisms. By including E. coli with

pET28a-flr, we may make a health-care yogurt to be

consumed after meals, which is beneficial for human

well-being advancement.

REFERENCES

Ashrafizadeh, M; Ahmadi, Z; Farkhondeh, T;

Samarghandian, S. Autophagy regulation using

luteolin: new insight into its anti-tumor activity. Cancer

Cell Int. 2020-11-04;20(1):537.

Chen, L; Cao, H; Huang, Q; Teng, H, et al. Absorption,

metabolism and bioavailability of flavonoids: a review.

CRIT REV FOOD SCI. 2021-06-03:1-13.

Gaohua Yang, Sen Hong, Pengjie Yang, et al. Discovery of

an ene-reductase for initiating flavone and flavonol

catabolism in gut bacteria, Nature communcations

(2021).

Geng, XF; Pang, XY; Li, GZ. The progress of research on

ginlcgobiobal flavone. Zhongguo Zhong Yao Za Zhi.

2003-06-01;28(6):488-90.

Jeon, YM; Kim, BG; Ahn, JH. Biological synthesis of 7-O-

methyl Apigenin from naringenin using escherichia

coli expressing two genes. J MICROBIOL

BIOTECHN. 2009-05-01;19(5):491-4.

Leonard, E; Chemler, J; Lim, KH; Koffas, MA. Expression

of a soluble flavone synthase allows the biosynthesis of

phytoestrogen derivatives in Escherichia coli. APPL

MICROBIOL BIOT. 2006-03-01;70(1):85-91.

Ravishankar D, Rajora A K, Greco F, et al. Flavonoids as

prospective compounds for anti-cancer therapy [J]. Int

J Bio- chem Cell Biol, 2013, 45(12):2821-283.

Tang, D; Chen, K; Huang, L; Li, J. Pharmacokinetic

properties and drug interactions of apigenin, a natural

flavone. EXPERT OPIN DRUG MET. 2017-03-

01;13(3):323-330.

Thilakarathna S H, Rupasinghe HP. Flavonoids

Bioavailability and attempts for bioavailability

enhancement [J]. Nutrients, 2013, 5(9):3367-3387

Yao, LH; Jiang, YM; Shi, J; Chen, SS, et al. Flavonoids in

food and their health benefits. PLANT FOOD HUM

NUTR. 2004-01-01;59(3):113-22.

Utilization of Intestinal Probiotics to Improve the Degradation and Absorption of Food and Drug Homologous Flavonoids